Abstract
Objective
Activation of brown adipose tissue is a promising strategy to treat and prevent obesity and obesity-related disorders. Activation of uncoupling protein 1 (UCP1) leads to uncoupled respiration and dissipation of stored energy as heat. Induction of UCP1-rich adipocytes in white adipose tissue, a process known as ‘browning’, serves as an alternative strategy to increase whole body uncoupling capacity. Here, we aim to assess the association between parathyroid hormone (PTH) receptor expression and UCP1 expression in human adipose tissues and to study PTH effects on human white and brown adipocyte lipolysis and UCP1 expression.
Design
A descriptive study of human neck adipose tissue biopsies substantiated by an interventional study on human neck-derived adipose tissue cell models.
Methods
Thermogenic markers and PTH receptor gene expression are assessed in human neck adipose tissue biopsies and are related to individual health records. PTH-initiated lipolysis and thermogenic gene induction are assessed in cultured human white and brown adipocyte cell models. PTH receptor involvement is investigated by PTH receptor silencing.
Results
PTH receptor gene expression correlates with UCP1 gene expression in the deep-neck adipose tissue in humans. In cell models, PTH receptor stimulation increases lipolysis and stimulates gene transcription of multiple thermogenic markers. Silencing of the PTH receptor attenuates the effects of PTH indicating a direct PTH effect via this receptor.
Conclusion
PTH 1 receptor stimulation by PTH may play a role in human adipose tissue metabolism by affecting lipolysis and thermogenic capacity.
Introduction
Evidence of active and physiologically relevant brown adipose tissue (BAT) in adult man has emerged within the last decades (1, 2, 3, 4). This observation has escalated the search for strategies for human BAT induction as a possible treatment for obesity and other metabolic diseases (5). Presence of BAT in adult humans is correlated with lower body weight (2), lower plasma cholesterols (6) and improved glucose homeostasis (4, 6). Physiological activation of BAT can be mediated through norepinephrine released by the sympathetic nervous system during cold exposure (7). Beta-adrenergic stimulation activates uncoupling protein 1 (UCP1) residing in the inner mitochondrial membrane and increases gene transcription leading to higher UCP1 levels (8). Activation of UCP1 increases mitochondrial uncoupling whereby stored energy-rich substrates are dissipated as heat, a process known as non-shivering thermogenesis (9). Long-term exposure to cold or beta-adrenergic agonism leads to increased thermogenic transformation of white adipose tissue (WAT) and increased thermogenic potential in BAT, processes known as ‘browning’ or ‘beiging’ (10, 11). Besides beta-adrenergic agonists, other compounds have been proposed to either directly or indirectly increase UCP1 abundance and hence cause browning of WAT (12).
Regulation of BAT function and expansion has been intensively investigated in rodent models both in vitro and in vivo (7). The sparse distribution in humans (13) and the lack of qualified cell models have proven human investigations difficult to conduct. A few studies have shown that factors that regulate BAT in rodents may not show the same potential in humans (14, 15). Thus, in order to obtain better insight in the regulation of human BAT, we recently introduced two new human immortalized polyclonal cell models derived from neck adipose tissue (AT) biopsies: a BAT cell model (TERT-hBA) and a WAT cell model (TERT-hWA) (16).
Parathyroid hormone (PTH) and tumor-derived parathyroid hormone-related protein (PTHrP) are proposed regulators of BAT size and activation (17, 18). They are closely related proteins acting through the same receptor, the PTH receptor (PTH1R), which can be coupled to different G proteins (19). Upon PTH1R activation, cAMP concentrations increase through a Gαs pathway (20). A rise in cAMP and protein kinase A (PKA) activation through this pathway could to some extent mimic the effect of beta-adrenergic receptor stimulation (21, 22). Although primarily involved in calcium and bone metabolism (23, 24) PTHrP is also linked to cachexia-induced thermogenesis and browning of WAT in murine models of tumor-induced cachexia (17). A link between cachexia and increased BAT activity has been recognized for decades and the condition has previously been described in children with malignant disease, without establishing a cause (25). Chronic kidney disease is another condition with elevated PTH and an experimental murine disease model displays increased browning of WAT (18). In humans, the condition is associated with presence of BAT (18) and increased plasma PTH levels are inversely correlated to BMI (26). Additionally, patients with high levels of PTH due to severe hyperparathyroidism have increased resting energy expenditure (26, 27) and PTH has been shown to induce lipolysis in human white fat (28). Recently, a study showed that differentiated and cultured s.c. preadipocytes express PTHR and respond to PTH by increasing energy expenditure and inducing the thermogenic program (29). However, a study on G-protein-coupled receptors in human s.c. adipose tissue found only trace levels of PTH1R (30), concluding that the receptor subtypes mediating the lipolytic action of PTH remain unclear. To our knowledge this is the only study assessing the presence and transcript levels of PTHR in human AT.
Under the hypothesis that PTH directly stimulates BAT activity and mediates browning of WAT, we investigated human neck adipose tissue biopsies to assess whether gene expression of thermogenic markers correlate to plasma PTH or PTH1R expression in adult humans. In addition, we studied the effects of PTH treatment on thermogenic gene markers and lipolysis in the human brown and white adipocyte cell models.
Subjects and methods
Study design and study population
A total of 54 patients were included in this cross-sectional study. Of these, 41 patients had one or more AT biopsies sampled from the deep-neck area. Biopsies from one person was preserved for immunostaining leaving samples from 40 patients for RNA extraction. The characteristics of these subjects can be seen in Table 1. An additional 13 patients had AT biopsies from both the s.c. neck and the deep-neck AT depot; these biopsies were used to assess difference in expression patterns between the two depots. The patients were admitted for elective neck surgery at Aarhus University Hospital. During surgery, AT biopsies were taken from the AT located in the deep-neck area surrounding the vessels, thyroid and parathyroid glands as previously described (31). Conditions in the parathyroid gland (mostly primary hyperparathyroidism) was the main cause of surgery but also patients with diseases in the thyroid gland (malignant or benign) were included. Plasma PTH (P-PTH) was assessed in 40 patients within the preceding 4 weeks of surgery. Exclusion criteria for all study subjects were systemic treatment with beta-adrenergic antagonists or agonists and metabolic diseases such as diabetes and hyperthyroidism. General health status was obtained from the patient’s health records.
Patient characteristics. Data are presented as median (range) where available. Of the 40 patients who had at least one deep-neck AT biopsy and a plasma PTH taken within 4 weeks of surgery, 24 patients had PTH above the normal reference interval. A division into two groups based on normal or raised plasma parathyroid hormone (P-PTH) levels revealed minor differences between the two groups. The first column represents the normal range and the second column represents patients with P-PTH above the reference range. Difference between groups were analyzed by student’s t-test and differences within the subdivision of groups was analyzed by Pearson’s Chi-squared test.
| P-PTH (pmol/L) | P-value | ||
|---|---|---|---|
| 2.9–6.9 | 7.0–25.9 | ||
| n | 16 | 24 | – |
| Age (years) | 55 (21–69) | 63 (39–74)* | 0.03 |
| Gender (female/male) | 11/5 | 14/10 | 0.51 |
| BMI (kg/m2) | 25.6 (16.8–37.9) | 27.4 (19.7–42.2) | 0.31 |
| Benign/malignant | 10/6 | 21/3 | 0.06 |
| Season (summer/winter) | 7/9 | 18/6 | 0.05 |
| Plasma PTH (pmol/L) | 4.7 (2.9–6.9) | 13.65 (7.0–25.9) | <0.0001 |
| Number of deep-neck biopsies | 36 | 49 | – |
Bold values are P <0.05.
*Presented as CI.
Informed written consent was obtained from all the study participants. The study was performed in accordance with the Helsinki declaration and was approved by the Central Denmark Region Ethics Committee.
Adipose tissue biopsies for RT-qPCR analysis
Suitable biopsies were located by surgical dissection based on the darker color of the tissue (13, 31, 32) and were primarily collected from the area known as ‘level 6’ (33) just behind and above the sternum. More than one biopsy was taken from the deep neck, if multiple areas looked promising. The s.c. AT biopsies were taken from the incision area just after the deep-neck AT biopsies were taken. All biopsies were taken between 1 and 3 h after the beginning of anesthetization and after completion of the elective operation. Biopsies were snap frozen in liquid nitrogen and stored at −80°C until analysis.
Cell culture studies
The brown TERT-hBA (n = 5, passage 8–9) and white TERT-hWA (n = 5, passage 7–11), human adipocyte-derived immortalized cell models from a single donor (euthyroid with normal plasma PTH), were treated as previously described (16). In short, both cell models were treated with rosiglitazone (1 μM), human cortisol (1 μM), T3 (1 nM), insulin (5 μg/mL) and dexamethasone (1 μM) in the early differentiation step. From day 6, rosiglitazone, cortisol, T3, insulin and dexamethasone were omitted from the medium. On day 11 of differentiation, cells were considered mature and were incubated with either vehicle (saline) or 100 nM PTH (1–84) (Sigma Aldrich P7036) (16, 17, 21). Beta-adrenergic stimulation by isoproterenol (10 µM) (Sigma Cat# I-6504) or direct increments in intracellular cAMP by incubation with dbcAMP (500 µM) (Sigma Cat# D0627) were used as controls.
All solutions were preheated to 37°C. After 4 h of incubation, cells and media were collected, snap frozen in liquid nitrogen and kept at −80°C until the day of RNA isolation. To minimize variation based on differentiation differences, cells were visually inspected and only wells containing lipid droplet-rich cells were assessed in the study.
PTH1R silencing was performed in free floating trypsinated cells by lipofectamine (ThermoFisher Cat# 13778075) transfection of PTH1R siRNA (ThermoFisher Cat#4392420) or negative control siRNA (ThermoFisher Cat# 4390843) in OptiMEM-medium in the final step of differentiation and 72 h before PTH treatment.
RNA isolation and quantitative real-time PCR
RNA was extracted by TRIzol as previously described (31). Before qPCR analyses of target genes, an array of potential reference genes was tested for stability, and peptidylprolyl isomerase A (cyclophilin A or PPIA) was found superior. Target gene levels are expressed relative to this gene. The primer pairs, of which some were designed using QuantPrime software (34), were as follows:
CIDEA, fwd: 5’-CGGCTGCCTTAACGTGAA-3’, rev: 5’-AGATGAGAAACTGTCCCATCA-3’; DIO2, fwd: 5’-CCTCCTCGATGCCTACAAAC-3’, rev: 5’-GCTGGCAAAGTCAAGAAGGT-3’; PGC1α, fwd: 5’-TTGAAGAGCGCCGTGTGATT-3’, rev: 5’-TGTCTCCATCATCCCGCAGAT-3’; PPIA, fwd: 5’-TCCTGGCATCTTGTCCAT-3’, rev: 5’-TGCTGGTCTTGCCATTCCT-3’; PRDM16, fwd: 5’- CGAGGCCCCTGTCTACATTC -3’, rev: 5’- GCTCCCATCCGAAGTCTGTC -3’; PTH1R, fwd: 5’-TTCTGCAACGGCGAGGTACAAG-3’, rev: 5’-TTGAAGTCCAGTGCCAGTGTCC-3’; UCP1, fwd: 5’-TCCTCACCGCAGGGAAAGAAAC-3’, rev: 5’-TTTCACGACCTCTGTGGGTTGC-3’.
The PCR protocol used was: 10 s at 95°C, 20 s at 60°C and 10 s at 72°C. An increase in fluorescence was measured in real time during the extension step.
Immunostaining
A human deep-neck adipose tissue sample from a single donor was fixed in 4% formalin buffer (Cellpath, Newtown, UK) and embedded in paraffin. Sections of 5 µm were heated at 60°C for 60 min, deparaffinized in Tissue-Clear (Sakura Finetek Europe, Alphan, the Netherlands) and treated with citrate buffer in microwave oven for 2 × 5 min at 800 W. Slices were then treated with 0.2% triton for 20 min and blocked in fetal calf serum + 1% BSA in phosphate buffered saline. TERT-hBA cells were grown on poly-L-lysine coated coverslips and differentiated. After differentiation, the cells were washed in PBS, fixed in a 4% paraformaldehyde solution for 20 min, washed in PBS ×3 and kept in PBS at 4°C until stained. Sections and cover slides were incubated overnight with or without antibodies against UCP1 (AbCam, Cat# ab23841) and PTH1R (Sigma Prestige antibody Cat#HPA007978) and cover slides additionally with a perilipin antibody (AbCam, Cat# ab61682). After multiple washes, sections were incubated with secondary antibodies (Molecular Probes Donkey anti-Rabbit IgG Cat# A11057 or Invitrogen Cat#A11055), anti-goat (Molecular Probes Donkey anti-Goat IgG Cat#A11057), DAPI (Sigma Cat#D9542) and Wheat Germ Agglutinin (WGA) Alexa Fluor™ 488 Conjugate (Invitrogen Cat# W11261)
Brightfield and widefield fluorescence scanning was performed using an upright widefield fluorescence slide scanner (Olympus VS120) with a Hamamatsu ORCA-FLASH4.0V2 monochrome camera. Images were assessed using the ‘OlympusViewer’ plugin in ImageJ.
Glycerol release
Glycerol release into cell culture medium was assessed according to the manufacturer’s instructions (Sigma Aldrich #MAK117). In short, glycerol concentrations were determined by a coupled enzymatic assay involving glycerol kinase and glycerol phosphate oxidase resulting in a fluorometric product that is proportional to the glycerol concentration in the sample. A master reaction mix containing assay buffer, enzyme mix, ATP and dye reagent was freshly made before the reaction was run. Samples and a standard glycerol curve were subsequently run in duplicates. The concentration of glycerol in the samples was determined from the standard curve.
Statistical analysis
When assessing potential correlations, linear regression analysis was used and the goodness of fit is displayed as R-squared (r2). Logarithmic transformation was performed when needed to achieve a Gaussian distribution, which was assessed by qq-plots. As the deep-neck AT biopsies displayed a large degree of heterogeneity, each deep-neck biopsy was considered as a separate entity and analyzed as such (31, 32). As multiple biopsies from a single individual cannot be considered independent, biopsies were clustered on the level of the individual with the statistical method, vce(cluster clustvar) in STATA. Cluster variation analysis allows for intrapersonal correlation to be taken into account (35, 36). Pearson’s Chi-squared test was used to compare differences within the subdivision of groups. Data are expressed as mean or median with the respective CI. Adjustments for known potential confounders were made in all linear regression analyses. Dunnett’s multiple comparisons test or Tukey’s multiple comparisons test were used where applicable for assessing effects of interventions in in vitro studies.
Statistical analyses were performed using GraphPad Prism 8.0.1 for Windows (GraphPad Software Inc.) and STATA 13.1 for Windows (StataCorp).
Results
PTH receptor expression correlates with thermogenic markers in human AT biopsies
The expression of UCP1 and PTH1R was significantly higher in deep-neck AT as compared to s.c. neck AT (P = 0.0008 and P = 0.02, respectively) (Fig. 1A and B). When examining the heterogeneous adipose tissue residing in the deep neck, we found a positive correlation between UCP1 and PTH1R expression (P = 0.042) indicating that biopsies with more thermogenic cells have higher PTH1R levels. When adjusting for potential confounders (age, gender, BMI, benign/malignant disease and season of year), the correlation strengthened (adjusted R2 = 0.34, P = 0.002) (Fig. 1C). In addition, a positive-adjusted correlation with PTH1R was found for two additional thermogenic markers, CIDEA and PGC1α (R2 = 0.53, P < 0.0001 and R2 = 0.16, P = 0.07, respectively) whereas no correlation was found for the two other markers, DIO2 (P = 0.15) and PRDM16 (P = 0.22) (data not shown). The PTHR2 mRNA was not detectable in these cell models (results not shown). Immunofluorescent staining of a deep-neck biopsy showed that both PTH1R and UCP1 translate into protein (Fig. 1D and E). Additionally, the staining revealed a rather higher concentration of cytosolic, nuclear and perinuclear PTH1R.
Analysis of UCP1 and PTH1R gene expression levels in human adipose tissue biopsies. Adipose tissue (AT) depot comparison between s.c. neck AT (SubQ) (n = 13) and deep-neck AT (DNAT) (n = 20) from these 13 individuals. Uncoupling protein 1, UCP1, notice log scale on y-axis (A) and parathyroid hormone receptor 1, PTH1R, levels (B). Significance is based on unpaired t-test with Welch’s correction for difference in variance. (C) illustrates the correlation between mRNA levels of PTH1R and UCP1 gene expression levels in deep-neck AT biopsies (n = 85 from 40 different individuals). Data are adjusted for season, gender, BMI, benign/malignant and age. Immunostainings of two consecutive slices of DNAT from a single donor illustrating presence of PTH1R (D) and UCP1 (E) throughout the cytosol and with PTH1R additionally found at the membrane. Wheat Germ Agglutinin (WGA) labels glycoproteins in the plasma membrane. Scale bar: 100 µm. *P < 0.05, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Analysis of UCP1 and PTH1R gene expression levels in human adipose tissue biopsies. Adipose tissue (AT) depot comparison between s.c. neck AT (SubQ) (n = 13) and deep-neck AT (DNAT) (n = 20) from these 13 individuals. Uncoupling protein 1, UCP1, notice log scale on y-axis (A) and parathyroid hormone receptor 1, PTH1R, levels (B). Significance is based on unpaired t-test with Welch’s correction for difference in variance. (C) illustrates the correlation between mRNA levels of PTH1R and UCP1 gene expression levels in deep-neck AT biopsies (n = 85 from 40 different individuals). Data are adjusted for season, gender, BMI, benign/malignant and age. Immunostainings of two consecutive slices of DNAT from a single donor illustrating presence of PTH1R (D) and UCP1 (E) throughout the cytosol and with PTH1R additionally found at the membrane. Wheat Germ Agglutinin (WGA) labels glycoproteins in the plasma membrane. Scale bar: 100 µm. *P < 0.05, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Analysis of UCP1 and PTH1R gene expression levels in human adipose tissue biopsies. Adipose tissue (AT) depot comparison between s.c. neck AT (SubQ) (n = 13) and deep-neck AT (DNAT) (n = 20) from these 13 individuals. Uncoupling protein 1, UCP1, notice log scale on y-axis (A) and parathyroid hormone receptor 1, PTH1R, levels (B). Significance is based on unpaired t-test with Welch’s correction for difference in variance. (C) illustrates the correlation between mRNA levels of PTH1R and UCP1 gene expression levels in deep-neck AT biopsies (n = 85 from 40 different individuals). Data are adjusted for season, gender, BMI, benign/malignant and age. Immunostainings of two consecutive slices of DNAT from a single donor illustrating presence of PTH1R (D) and UCP1 (E) throughout the cytosol and with PTH1R additionally found at the membrane. Wheat Germ Agglutinin (WGA) labels glycoproteins in the plasma membrane. Scale bar: 100 µm. *P < 0.05, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
We next assessed whether UCP1 expression in the deep neck correlates with plasma PTH levels measured within 4 weeks prior to surgery. Plasma PTH levels ranged from 2.9 to 25.9 pmol/L, but we found no correlation between plasma PTH and UCP1 mRNA in our study cohort, neither unadjusted (R2 = 0.02, P = 0.32) nor adjusted (age, gender, BMI, benign/malignant and season) (R2 = 0.26, P = 0.999).
PTH boosts the thermogenic program in white and brown human cell models
To assess direct PTH mediated effects on the thermogenic program, we moved to in vitro cell model experiments using our immortalized human white and brown cell models. A dose-response study showed a robust induction in UCP1 gene expression by PTH (10–100 nM) in both white TERT-hWA and brown TERT-hBA cell models after 4 h of incubation (Fig. 2A and B). A further induction was seen in the TERT-hBA cell model when cells were incubated with the known stimulants isoproterenol and dbcAMP whereas the maximal stimulation observed in the TERT-hWA cell model was similar between the three compounds (Fig. 2A and B). Besides transcriptional regulation, PTH (10–100 nM) stimulation increased lipolysis in the two cell models as assessed by increased glycerol release to the media (Fig. 2C and D). As a positive control, we stimulated the cells with high doses of the two well-known lipolytic agents dbcAMP and isoproterenol.
Concentration-dependent PTH-mediated effects in human white and brown adipocyte cell models. Human white (TERT-hWA) and brown (TERT-hBA) adipocyte cell models were subjected to a parathyroid hormone (PTH) dose-response study. The beta-adrenergic agonist isoproterenol and/or direct increments in the downstream effector cAMP were used as positive controls. (A and B) Uncoupling protein 1 (UCP1) gene expression after 4 h of incubation and (C and D) the corresponding glycerol release. PTH concentration of 100 nM is depicted in black and presented as 100% to better visualize relative effects (n = 6–9 for each experiment). *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Concentration-dependent PTH-mediated effects in human white and brown adipocyte cell models. Human white (TERT-hWA) and brown (TERT-hBA) adipocyte cell models were subjected to a parathyroid hormone (PTH) dose-response study. The beta-adrenergic agonist isoproterenol and/or direct increments in the downstream effector cAMP were used as positive controls. (A and B) Uncoupling protein 1 (UCP1) gene expression after 4 h of incubation and (C and D) the corresponding glycerol release. PTH concentration of 100 nM is depicted in black and presented as 100% to better visualize relative effects (n = 6–9 for each experiment). *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Concentration-dependent PTH-mediated effects in human white and brown adipocyte cell models. Human white (TERT-hWA) and brown (TERT-hBA) adipocyte cell models were subjected to a parathyroid hormone (PTH) dose-response study. The beta-adrenergic agonist isoproterenol and/or direct increments in the downstream effector cAMP were used as positive controls. (A and B) Uncoupling protein 1 (UCP1) gene expression after 4 h of incubation and (C and D) the corresponding glycerol release. PTH concentration of 100 nM is depicted in black and presented as 100% to better visualize relative effects (n = 6–9 for each experiment). *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
In the subsequent experiments, we used PTH at a concentration of 100 nM to obtain maximal stimulation. At baseline, the thermogenic gene expression profile was found to differ substantially between the white and brown adipocyte cell models as can be seen by an approximate 100-fold higher UCP1 level in TERT-hBA cells compared to TERT-hWA (Fig. 3A). This large difference is partly due to the fact that the expression level of UCP1 mRNA was close to or below the detection limit in the TERT-hWA cell model. After 4 h of PTH stimulation, UCP1 expression increased by approximately five-fold in TERT-hBA cells compared to baseline levels (P < 0.001, Fig. 3A). In TERT-hWA cells, PTH was also found to stimulate UCP1 expression but fold increment was difficult to determine since baseline levels were extremely low (Fig. 3A). Upon PTH stimulation, the thermogenic markers PGC1α and DIO2 showed similar trends as UCP1 in both cell models but with basal expression higher in the TERT-hBA model. PGC1α expression increased 4.3-fold in TERT-hWA and 2.2-fold in TERT-hBA. DIO2 expression increased 4.2-fold in TERT-hWA and 2.3-fold in TERT-hBA, (Fig. 3A). Similar to the deep-neck biopsy, immunostaining for UCP1 and PTH1R in the TERT-hBA cell model revealed translation from mRNA to protein. Surprisingly, in this cell model most of the PTH1R was found to be located within or in close proximity of the nucleus (Fig. 3C and D).
Thermogenic markers, glycerol release and PTH1R staining in human white and brown adipocyte cell models. Human white and brown adipocyte cell model (TERT-hWA and TERT-hBA, respectively) incubated with saline (control) or parathyroid hormone (PTH) for 4 h (n = 5 in each group). (A) The thermogenic markers: Uncoupling protein 1 (UCP1), peroxisome proliferator–activated receptor γ coactivator-1α (PGC1α) and type 2 iodothyronine deiodinase (DIO 2) mRNA was determined by qPCR (log scale). (B) Glycerol release during these 4 h of PTH stimulation. Data are shown as mean (s.e.m.). TERT-hBA cells are stained by perilipin (PLIN), to illustrate lipid droplets in the differentiated cells. UCP1 is found in the cytoplasm of brown adipocytes only (C) and PTH1R is distributed in the cytoplasm and in the nucleus (D). PLIN is omitted in the inset to better illustrate UCP1 and PTH1R distribution. Scale bar: 20 µm. *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Thermogenic markers, glycerol release and PTH1R staining in human white and brown adipocyte cell models. Human white and brown adipocyte cell model (TERT-hWA and TERT-hBA, respectively) incubated with saline (control) or parathyroid hormone (PTH) for 4 h (n = 5 in each group). (A) The thermogenic markers: Uncoupling protein 1 (UCP1), peroxisome proliferator–activated receptor γ coactivator-1α (PGC1α) and type 2 iodothyronine deiodinase (DIO 2) mRNA was determined by qPCR (log scale). (B) Glycerol release during these 4 h of PTH stimulation. Data are shown as mean (s.e.m.). TERT-hBA cells are stained by perilipin (PLIN), to illustrate lipid droplets in the differentiated cells. UCP1 is found in the cytoplasm of brown adipocytes only (C) and PTH1R is distributed in the cytoplasm and in the nucleus (D). PLIN is omitted in the inset to better illustrate UCP1 and PTH1R distribution. Scale bar: 20 µm. *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Thermogenic markers, glycerol release and PTH1R staining in human white and brown adipocyte cell models. Human white and brown adipocyte cell model (TERT-hWA and TERT-hBA, respectively) incubated with saline (control) or parathyroid hormone (PTH) for 4 h (n = 5 in each group). (A) The thermogenic markers: Uncoupling protein 1 (UCP1), peroxisome proliferator–activated receptor γ coactivator-1α (PGC1α) and type 2 iodothyronine deiodinase (DIO 2) mRNA was determined by qPCR (log scale). (B) Glycerol release during these 4 h of PTH stimulation. Data are shown as mean (s.e.m.). TERT-hBA cells are stained by perilipin (PLIN), to illustrate lipid droplets in the differentiated cells. UCP1 is found in the cytoplasm of brown adipocytes only (C) and PTH1R is distributed in the cytoplasm and in the nucleus (D). PLIN is omitted in the inset to better illustrate UCP1 and PTH1R distribution. Scale bar: 20 µm. *P < 0.05, **P < 0.01, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Silencing of PTH1R attenuates PTH action on TERT cell models
To ascertain that PTH acts through its specific receptor, we used RNA silencing to reduce PTH1R expression in the TERT cell models (Fig. 4). PTH1R silencing let to a 91–94% reduction in PTH1R in TERT-hWA and 79–86% reduction in TERT-hBA (Fig. 4A). The massive PTH1R reduction abolished the lipolytic action of PTH in both cell models (Fig. 4B). The silencing protocol did not affect the stimulation elicited by isoprenaline and dbcAMP on UCP1 expression in the TERT-hBA cell model (Fig. 4C). However, silencing of PTH1R reduced UCP1 induction by 69% after stimulation with 100 nM PTH, compared to negative siRNA controls (Fig 4D). Thus, in the TERT-hBA cell model, PTH1R silencing specifically inhibited the effect of PTH. As shown previously, the expression of UCP1 is much lower in TERT-hWA compared to TERT-hBA, giving rise to phenotypical differences between the two models. Unfortunately, the silencing protocol reduced UCP1 expression levels below detection limit (data not shown). Accordingly, we were not able to evaluate the effect of silencing on the action of PTH on UCP1 in the white cell model.
PTH1R silencing in the adipocyte cell models. The TERT-hWA and TERT-hBA cell models were exposed to a 72-h silencing protocol which led to a more than 80% reduction in PTH1R in both cell models (A). (B) PTH1R silencing inhibited PTH mediated lipolysis. (C) The reduction in PTH1R did not affect UCP1 induction by isoproterenol nor dbcAMP in the TERT-hBA cell model (UCP1 induction could only be assessed in the TERT-hBA cell model). (D) The reduction in PTH1R resulted in a 70% decline in PTH-mediated UCP1 induction in the TERT-hBA cell model. (n = 3 in each group). *P < 0.05, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
PTH1R silencing in the adipocyte cell models. The TERT-hWA and TERT-hBA cell models were exposed to a 72-h silencing protocol which led to a more than 80% reduction in PTH1R in both cell models (A). (B) PTH1R silencing inhibited PTH mediated lipolysis. (C) The reduction in PTH1R did not affect UCP1 induction by isoproterenol nor dbcAMP in the TERT-hBA cell model (UCP1 induction could only be assessed in the TERT-hBA cell model). (D) The reduction in PTH1R resulted in a 70% decline in PTH-mediated UCP1 induction in the TERT-hBA cell model. (n = 3 in each group). *P < 0.05, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
PTH1R silencing in the adipocyte cell models. The TERT-hWA and TERT-hBA cell models were exposed to a 72-h silencing protocol which led to a more than 80% reduction in PTH1R in both cell models (A). (B) PTH1R silencing inhibited PTH mediated lipolysis. (C) The reduction in PTH1R did not affect UCP1 induction by isoproterenol nor dbcAMP in the TERT-hBA cell model (UCP1 induction could only be assessed in the TERT-hBA cell model). (D) The reduction in PTH1R resulted in a 70% decline in PTH-mediated UCP1 induction in the TERT-hBA cell model. (n = 3 in each group). *P < 0.05, ***P < 0.001.
Citation: European Journal of Endocrinology 184, 5; 10.1530/EJE-20-0713
Discussion
In the present study, we find that PTH initiates lipolysis and thermogenic gene transcription through activation of PTH1R. We find that PTH increases mRNA levels of multiple markers of thermogenesis in our human white and brown cell models while simultaneously increasing lipolysis. Our results add to the expanding knowledge on PTH-mediated effects on thermogenic capacity (26, 29) by establishing PTH1R activation as the key driver of the process.
Since PTH specifically mediates its effect through its G protein-coupled receptors (PTH1R and PTH2R), it is intriguing that we find high expression patterns of PTH1R in the human biopsies as well as in our adipocyte cell models. The fact that this expression pattern is preserved makes results from the TERT cell models credible and ideal for these in vitro investigations.
As demonstrated here and previously (16), the non-stimulated expression pattern of thermogenic markers is considerably lower in the TERT-hWA cell model compared to the TERT-hBA cell model. The fact that PTH is able to initiate lipolysis and increase transcription of thermogenic markers in both cell models indicate that the hormone may be able to initiate human thermogenesis while also inducing browning of human WAT. The latter may be of most importance for whole body energy expenditure since WAT is much larger than BAT. The effect of PTH on UCP1 and lipolysis seems rather similar to the effect of beta-adrenergic stimulation indicating that similar pathways may be involved. The acute activation of the UCP1 protein may mainly be mediated by FFA release during lipolysis (through cAMP, PKA-mediated phosphorylation, lipases, etc) whereas a chronic browning effect is likely due to cAMP/PKA-mediated transcriptional upregulation of UCP1 expression/protein (37). However, the present study clearly demonstrates that PTH via the PTH1R is able to increase UCP1 expression in human adipocytes but delineating the precise intracellular pathways involved warrants for further investigation. PTH stimulation has previously been shown to increase non-ATP linked respiration by adipocytes as a marker for increased uncoupling (29). However, these effects could not fully be attributed to the PTH receptor as its presence on adipocytes was questioned (30). Here, we clearly demonstrate that the effects of PTH on the adipocyte cell models are mediated directly via the PTH1R receptor as receptor silencing inhibited the lipolytic action in both white and brown cell models and attenuated PTH-mediated increase in UCP1 expression in the TERT-hBA adipocytes. The silencing protocol led to decreased transcription of UCP1 in the TERT-hWA cell model and hence, making it impossible to confirm this effect on gene expression in TERT-hWA cells. UCP1 expression is already very low in the white cell model and our silencing protocol further reduced the UCP1 expression below the detection limit. However, the fact that the lipolytic action was specifically blocked by PTH1R silencing in both cell models indicates that PTH mediates its effects by similar means in the two models.
Our in vitro studies support a membrane-bound G-protein-coupled receptor-initiated response from receptor activation as PTH via the PTH1R-induced lipolysis as indicated by the robust glycerol release from both adipocyte cell types. However, this may not be the only effect of PTH1R in adipocytes. Numerous studies, using various PTH1R antibodies, have shown that the receptor localizes to the cytosol and accumulates in the nucleus (38, 39, 40). The receptor has even been proposed to be responsible for nuclear-cytoplasmic shuttling (41). In our immunofluorescent staining of the cell model, we find that almost all PTH1R is localized in the cytosol or in the nucleus whereas we find a higher concentration at the membrane in the human biopsy. Fixation of our cell model was done with low levels of serum (2%) and without the presence of PTH in the media, both conditions have been shown to mediate nuclear localization of PTH1R (41). Whether the high degree of nuclear binding is merely an in vitro phenomenon cannot be ruled out, and further experiments are needed in order to determine the function of nuclear PTH1R localization.
To investigate a possible thermogenic gene induction by the circulating PTH in our study cohort, we assessed the relationship between plasma PTH and UCP1 expression. In contrast to recent studies by other groups (18, 26), we found no such correlations. The reason for this discrepancy is not clear. However, PTH released in bursts and plasma samples for PTH assessments were collected days to weeks before surgery which could possibly explain the lack of correlation between PTH and UCP1 expression. In addition, we are limited to transcriptional data and must therefore rely on the assumption that the genes are indeed transcribed and subsequently translated into protein. We know that for UCP1 this is indeed the case, as the correlation between mRNA and protein is high (42), but we do not know whether the same applies to PTH1R.
An interesting question is whether the endogenous plasma PTH levels reach sufficient levels to stimulate the adipose tissue as seen in our in vitro studies. We (and others) have used up to 4000 times higher PTH concentrations for in vitro studies compared to the plasma concentrations measured in our study cohort. This brings the role of physiological concentrations of PTH on thermogenic induction into question. However, patients with hyperparathyroidism, a pathological condition with increased endogenous plasma PTH levels, has recently been shown to exhibit more detectable BAT measured by PET/CT (26) hereby indicating that PTH at these concentrations may be sufficient to elicit browning and affect BAT/energy expenditure in vivo.
Additionally, PTHrP levels which are usually low or undetectable are increased during some forms of cancer to levels corresponding to those found during hyperparathyroidism and PTH administration (43). Circulating PTHrP at this pathological level has been proposed to induce browning of WAT in mice (17). It is possible to achieve comparable plasma levels of PTH by daily high-dose PTH-analog injections as part of anabolic osteoporosis treatment (44) without the metabolic complications (45, 46, 47) of the disease. Patients suffering from hyperparathyroidism have increased resting energy expenditure (27) and lipolytic effects of PTH in WAT can be observed at concentrations approximating the peak levels found during PTH therapy (21). Whether this treatment results in increased presence of BAT has, to our knowledge, never been investigated. We have no good explanation for the higher PTH concentration needed for stimulation of UCP1 expression in vitro but the similar effects of PTH in vivo and in vitro suggest that PTH and its receptor may regulate lipolysis as well as UCP1 expression in human brown and white adipocytes independent of the adrenergic/sympathetic nervous system
In conclusion, PTH1R is expressed at higher levels in the deep-neck AT compared to the s.c. AT in humans. Within the deep neck, PTH1R is higher in areas with increased expression of thermogenic markers. Using human brown and white adipocytes, we find that PTH acts directly via the PTH1R receptor to stimulate lipolysis and increase UCP1 expression. The combined results suggest that PTH via PTH1R stimulation may play a role for human adipose metabolism.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by The Novo Nordisk Foundation and The Department of Clinical Medicine, Aarhus University.
Acknowledgements
The authors thank Pia Hornbek, Lenette Pedersen, and Helle Zibrantsen for excellent technical laboratory assistance.
References
- 1↑
Nedergaard J, Bengtsson T & Cannon B Unexpected evidence for active brown adipose tissue in adult humans. American Journal of Physiology. Endocrinology & Metabolism 2007 293 E444–E452. (https://doi.org/10.1152/ajpendo.00691.2006)
- 2↑
van Marken Lichtenbelt WD, Vanhommerig JW, Smulders NM, Drossaerts JM, Kemerink GJ, Bouvy ND, Schrauwen P & Teule GJ Cold-activated brown adipose tissue in healthy men. New England Journal of Medicine 2009 360 1500–1508. (https://doi.org/10.1056/NEJMoa0808718)
- 3↑
Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC, Palmer EL, Tseng YH & Doria A et al.Identification and importance of brown adipose tissue in adult humans. New England Journal of Medicine 2009 360 1509–1517. (https://doi.org/10.1056/NEJMoa0810780)
- 4↑
Chondronikola M, Volpi E, Borsheim E, Porter C, Annamalai P, Enerback S, Lidell ME, Saraf MK, Labbe SM & Hurren NM et al.Brown adipose tissue improves whole body glucose homeostasis and insulin sensitivity in humans. Diabetes 2014 63 4089–4099. (https://doi.org/10.2337/db14-0746)
- 5↑
Kusminski CM, Bickel PE & Scherer PE Targeting adipose tissue in the treatment of obesity-associated diabetes. Nature Reviews. Drug Discovery 2016 15 639–660. (https://doi.org/10.1038/nrd.2016.75)
- 6↑
Matsushita M, Yoneshiro T, Aita S, Kameya T, Sugie H & Saito M Impact of brown adipose tissue on body fatness and glucose metabolism in healthy humans. International Journal of Obesity 2014 38 812–817. (https://doi.org/10.1038/ijo.2013.206)
- 7↑
Cannon B & Nedergaard J Brown adipose tissue: function and physiological significance. Physiological Reviews 2004 84 277–359. (https://doi.org/10.1152/physrev.00015.2003)
- 8↑
Bouillaud F, Ricquier D, Mory G & Thibault J Increased level of mRNA for the uncoupling protein in brown adipose tissue of rats during thermogenesis induced by cold exposure or norepinephrine infusion. Journal of Biological Chemistry 1984 259 11583–11586. (https://doi.org/10.1016/S0021-9258(1890902-6)
- 9↑
Inokuma K-I, Okamatsu-Ogura Y, Omachi A, Matsushita Y, Kimura K, Yamashita H & Saito M Indispensable role of mitochondrial UCP1 for antiobesity effect of β 3-adrenergic stimulation. American Journal of Physiology. Endocrinology & Metabolism 2006 290 E1014–E1021. (https://doi.org/10.1152/ajpendo.00105.2005)
- 10↑
Kalinovich AV, de Jong JM, Cannon B & Nedergaard J UCP1 in adipose tissues: two steps to full browning. Biochimie 2017 134 127–137. (https://doi.org/10.1016/j.biochi.2017.01.007)
- 11↑
Bartelt A & Heeren J Adipose tissue browning and metabolic health. Nature Reviews. Endocrinology 2014 10 24–36. (https://doi.org/10.1038/nrendo.2013.204)
- 12↑
Nedergaard J & Cannon B The browning of white adipose tissue: some burning issues. Cell Metabolism 2014 20 396–407. (https://doi.org/10.1016/j.cmet.2014.07.005)
- 13↑
Cypess AM, White AP, Vernochet C, Schulz TJ, Xue R, Sass CA, Huang TL, Roberts-Toler C, Weiner LS & Sze C et al.Anatomical localization, gene expression profiling and functional characterization of adult human neck brown fat. Nature Medicine 2013 19 635–639. (https://doi.org/10.1038/nm.3112)
- 14↑
Murholm M, Isidor MS, Basse AL, Winther S, Sørensen C, Skovgaard-Petersen J, Nielsen MM, Hansen AS, Quistorff B & Hansen JB Retinoic acid has different effects on UCP1 expression in mouse and human adipocytes. BMC Cell Biology 2013 14 41. (https://doi.org/10.1186/1471-2121-14-41)
- 15↑
Zhang Q, Miao Q, Ye H, Zhang Z, Zuo C, Hua F, Guan Y & Li Y The effects of thyroid hormones on brown adipose tissue in humans: a PET-CT study. Diabetes/Metabolism Research & Reviews 2014 30 513–520. (https://doi.org/10.1002/dmrr.2556)
- 16↑
Markussen LK, Isidor MS, Breining P, Andersen ES, Rasmussen NE, Petersen LI, Pedersen SB, Richelsen B & Hansen JB Characterization of immortalized human brown and white pre-adipocyte cell models from a single donor. PLOS ONE 2017 12 e0185624. (https://doi.org/10.1371/journal.pone.0185624)
- 17↑
Kir S, White JP, Kleiner S, Kazak L, Cohen P, Baracos VE & Spiegelman BM Tumour-derived PTH-related protein triggers adipose tissue browning and cancer cachexia. Nature 2014 513 100–104. (https://doi.org/10.1038/nature13528).
- 18↑
Kir S, Komaba H, Garcia AP, Economopoulos KP, Liu W, Lanske B, Hodin RA & Spiegelman BM PTH/PTHrP receptor mediates cachexia in models of kidney failure and cancer. Cell Metabolism 2016 23 315–323. (https://doi.org/10.1016/j.cmet.2015.11.003)
- 19↑
Juppner H, Abou-Samra AB, Freeman M, Kong XF, Schipani E, Richards J, Kolakowski LF Jr, Hock J, Potts JT Jr & Kronenberg HM AG protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 1991 254 1024–1026. (https://doi.org/10.1126/science.1658941)
- 20↑
Bastepe M, Turan S & He Q Heterotrimeric G proteins in the control of parathyroid hormone actions. Journal of Molecular Endocrinology 2017 58 R203–R224. (https://doi.org/10.1530/JME-16-0221)
- 21↑
Taniguchi A, Kataoka K, Kono T, Oseko F, Okuda H, Nagata I & Imura H Parathyroid hormone-induced lipolysis in human adipose tissue. Journal of Lipid Research 1987 28 490–494. (https://doi.org/10.1016/S0022-2275(2038677-6)
- 22↑
Larsson S, Jones HA, Göransson O, Degerman E & Holm C Parathyroid hormone induces adipocyte lipolysis via PKA-mediated phosphorylation of hormone-sensitive lipase. Cellular Signalling 2016 28 204–213. (https://doi.org/10.1016/j.cellsig.2015.12.012)
- 23↑
Martin TJ Parathyroid hormone-related protein, its regulation of cartilage and bone development, and role in treating bone diseases. Physiological Reviews 2016 96 831–871. (https://doi.org/10.1152/physrev.00031.2015)
- 24↑
Silva BC & Bilezikian JP Parathyroid hormone: anabolic and catabolic actions on the skeleton. Current Opinion in Pharmacology 2015 22 41–50. (https://doi.org/10.1016/j.coph.2015.03.005)
- 25↑
Bianchi A, Bruce J, Cooper AL, Childs C, Kohli M, Morris ID, Morris-Jones P & Rothwell NJ Increased brown adipose tissue activity in children with malignant disease. Hormone & Metabolic Research 1989 21 640–641. (https://doi.org/10.1055/s-2007-1009308)
- 26↑
He Y, Liu RX, Zhu MT, Shen WB, Xie J, Zhang ZY, Chen N, Shan C, Guo XZ & Lu YD et al.The browning of white adipose tissue and body weight loss in primary hyperparathyroidism. EBiomedicine 2019 40 56–66. (https://doi.org/10.1016/j.ebiom.2018.11.057)
- 27↑
Cuppari L, de Carvalho AB, Avesani CM, Kamimura MA, dos Santos Lobão RR & Draibe SA Increased resting energy expenditure in hemodialysis patients with severe hyperparathyroidism. Journal of the American Society of Nephrology 2004 15 2933–2939. (https://doi.org/10.1097/01.ASN.0000141961.49723.BC)
- 28↑
Gozariu L, Forster K, Faulhaber JD, Minne H & Ziegler R Parathyroid hormone and calcitonin: influences upon lipolysis of human adipose tissue. Hormone & Metabolic Research 1974 6 243–245. (https://doi.org/10.1055/s-0028-1095713)
- 29↑
Hedesan OC, Fenzl A, Digruber A, Spirk K, Baumgartner-Parzer S, Bilban M, Kenner L, Vierhapper M, Elbe-Burger A & Kiefer FW Parathyroid hormone induces a browning program in human white adipocytes. International Journal of Obesity 2019 43 1319–1324. (https://doi.org/10.1038/s41366-018-0266-z)
- 30↑
Amisten S, Neville M, Hawkes R, Persaud SJ, Karpe F & Salehi A An atlas of G-protein coupled receptor expression and function in human subcutaneous adipose tissue. Pharmacology & Therapeutics 2015 146 61–93. (https://doi.org/10.1016/j.pharmthera.2014.09.007)
- 31↑
Breining P, Pedersen SB, Pikelis A, Rolighed L, Sundelin EIO, Jessen N & Richelsen B High expression of organic cation transporter 3 in human BAT-like adipocytes. Implications for extraneuronal norepinephrine uptake. Molecular & Cellular Endocrinology 2017 443 15–22. (https://doi.org/10.1016/j.mce.2016.12.024)
- 32↑
Jespersen NZ, Larsen TJ, Peijs L, Daugaard S, Homoe P, Loft A, de Jong J, Mathur N, Cannon B & Nedergaard J et al.A classical brown adipose tissue mRNA signature partly overlaps with Brite in the supraclavicular region of adult humans. Cell Metabolism 2013 17 798–805. (https://doi.org/10.1016/j.cmet.2013.04.011)
- 33↑
Patel KN & Shah JP Neck dissection: past, present, future. Surgical Oncology Clinics of North America 2005 14 461–77, vi, vi. (https://doi.org/10.1016/j.soc.2005.04.003).
- 34↑
Arvidsson S, Kwasniewski M, Riano-Pachon DM & Mueller-Roeber B QuantPrime: a flexible tool for reliable high-throughput primer design for quantitative PCR. BMC Bioinformatics 2008 9 465. (https://doi.org/10.1186/1471-2105-9-465)
- 36↑
Froot KA Consistent covariance matrix estimation with cross-sectional dependence and heteroskedasticity in financial data. Journal of Financial & Quantitative Analysis 1989 24 333–355. (https://doi.org/10.2307/2330815)
- 37↑
Ježek P, Jabůrek M & Porter RK Uncoupling mechanism and redox regulation of mitochondrial uncoupling protein 1 (UCP1). Biochimica et Biophysica Acta-Bioenergetics 2019;1860 3 259–269.
- 38↑
Pickard BW, Hodsman AB, Fraher LJ & Watson PH Type 1 parathyroid hormone receptor (PTH1R) nuclear trafficking: association of PTH1R with importin α1 and β. Endocrinology 2006 147 3326–3332. (https://doi.org/10.1210/en.2005-1408)
- 39↑
Watson PH, Fraher LJ, Natale BV, Kisiel M, Hendy GN & Hodsman AB Nuclear localization of the type 1 parathyroid hormone/parathyroid hormone-related peptide receptor in MC3T3-E1 cells: association with serum-induced cell proliferation. Bone 2000 26 221–225. (https://doi.org/10.1016/s8756-3282(9900264-1)
- 40↑
Garcia-Martin A, Ardura JA, Maycas M, Lozano D, Lopez-Herradon A, Portal-Nunez S, Garcia-Ocana A & Esbrit P Functional roles of the nuclear localization signal of parathyroid hormone-related protein (PTHrP) in osteoblastic cells. Molecular Endocrinology 2014 28 925–934. (https://doi.org/10.1210/me.2013-1225)
- 41↑
Pickard BW, Hodsman AB, Fraher LJ & Watson PH Type 1 parathyroid hormone receptor (PTH1R) nuclear trafficking: regulation of PTH1R nuclear-cytoplasmic shuttling by importin-α/β and chromosomal region maintenance 1/exportin. Endocrinology 2007 148 2282–2289. (https://doi.org/10.1210/en.2007-0157)
- 42↑
Nedergaard J & Cannon B UCP1 mRNA does not produce heat. Biochimica & Biophysica Acta 2013 1831 943–949. (https://doi.org/10.1016/j.bbalip.2013.01.009)
- 43↑
Grill V, Murray RM, Ho PW, Santamaria JD, Pitt P, Potts C, Jerums G & Martin TJ Circulating PTH and PTHrP levels before and after treatment of tumor induced hypercalcemia with pamidronate disodium (APD). Journal of Clinical Endocrinology & Metabolism 1992 74 1468–1470. (https://doi.org/10.1210/jcem.74.6.1592895)
- 44↑
Shiraki M, Sugimoto T & Nakamura T Effects of a single injection of teriparatide on bone turnover markers in postmenopausal women. Osteoporosis International 2013 24 219–226. (https://doi.org/10.1007/s00198-012-2159-7)
- 45↑
Bilezikian JP, Bandeira L, Khan A & Cusano NE Hyperparathyroidism. Lancet 2018 391 168–178. (https://doi.org/10.1016/S0140-6736(1731430-7)
- 46↑
Mak RH, Bettinelli A, Turner C, Haycock GB & Chantler C The influence of hyperparathyroidism on glucose metabolism in uremia. Journal of Clinical Endocrinology & Metabolism 1985 60 229–233. (https://doi.org/10.1210/jcem-60-2-229)
- 47↑
Bolland MJ, Grey AB, Gamble GD & Reid IR Association between primary hyperparathyroidism and increased body weight: a meta-analysis. Journal of Clinical Endocrinology & Metabolism 2005 90 1525–1530. (https://doi.org/10.1210/jc.2004-1891)
